![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dme-mir-276b |
|||||
Accession | MI0000375 (change log) | ||||
Description | Drosophila melanogaster miR-276b stem-loop | ||||
Gene family | MIPF0000124; mir-276 | ||||
Literature search |
![]()
12 open access papers mention dme-mir-276b | ||||
Stem-loop |
aaaac - uuua uc a a uuc au 5' cga agucuu cca agcg gguau gaguuccuacg cu a ||| |||||| ||| |||| ||||| ||||||||||| || 3' gcu ucagga ggu ucgu ccaua uucaaggaugc ga u --cca g ---- uc g a --u cu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence dme-miR-276b-5p |
|
Accession | MIMAT0020815 |
Sequence |
23 - cagcgagguauagaguuccuacg - 45 |
Deep sequencing | 220380 reads, 49 experiments |
Evidence | experimental; Northern [1], 454 [3-4], Illumina [4] |
Database links |
|
Mature sequence dme-miR-276b-3p |
|
Accession | MIMAT0000354 |
Previous IDs | dme-miR-276b |
Sequence |
62 - uaggaacuuaauaccgugcucu - 83 |
Deep sequencing | 5625476 reads, 49 experiments |
Evidence | experimental; Northern [1], cloned [2], 454 [3-4], Illumina [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12844358
"Computational identification of Drosophila microRNA genes"
Genome Biol. 4:R42(2003).
|
2 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
3 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
4 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|