Stem-loop sequence dme-mir-34

Accession

MI0000371 (change log)

Description

Drosophila melanogaster miR-34 stem-loop

Gene family

MIPF0000039; mir-34

Literature search

35 open access papers mention dme-mir-34
(371 sentences)

Stem-loop

   aauug   a  -   uu        u  u   c        --ua c    ua 
5'      gcu ug cgc  uggcagug gg uag ugguugug    g caau  u
        ||| || |||  |||||||| || ||| ||||||||    | ||||  u
3'      cga ac gcg  gccgucac uc auc accgacac    c guug  g
   -----   -  a   cc        u  u   -        uuaa a    cc 

Deep sequencing

3716255 reads, 3.77e+04 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This sequence is computationally predicted based on conservation in D. pseudoobscura and C. elegans. The precise 5' or 3' ends are unknown. Expression in D. melanogaster was confirmed by Northern blot analysis [1]. Aravin et al. later identify the 5' and 3' ends by cloning [3].

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr3R: 10100936-10101034 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from dme-mir-34

• dme-mir-317: chr3R: 10091126-10091217 [+]
• dme-mir-277: chr3R: 10100022-10100121 [+]
• dme-mir-34: chr3R: 10100936-10101034 [+]

Database links

• RNAcentral:URS0000793AE5_7227
• miRBase Tracker:MI0000371

Mature sequence dme-miR-34-5p

• Accession: MIMAT0000350
• Previous IDs: dme-miR-34
• Sequence: 17 - uggcagugugguuagcugguugug - 40
• Deep sequencing: 3543094 reads, 49 experiments
• Evidence: experimental; Northern [1], cloned [3], 454 [4-5], Illumina [5]
• Database links:
  • RNAcentral:URS0000281B10_7227
• Predicted targets:
  • TargetScanFly:dme-miR-34
  • microrna.org:dme-miR-34-5p

Mature sequence dme-miR-34-3p

• Accession: MIMAT0020812
• Sequence: 68 - cagccacuaucuucacugccgcc - 90
• Deep sequencing: 135429 reads, 49 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS00003730F6_7227

References

1. PMID:12812784 "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity" Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V Dev Biol. 259:9-18(2003).
2. PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).