![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dme-mir-281-2 |
||||||
Accession | MI0000370 (change log) | |||||
Description | Drosophila melanogaster miR-281-2 stem-loop | |||||
Gene family | MIPF0000087; mir-46 | |||||
Literature search |
![]()
13 open access papers mention dme-mir-281-2 | |||||
Stem-loop |
u gaa ug -ua c ---ca aa 5' cgaau gu a aagagagc uccgu gacagu aguu g ||||| || | |||||||| ||||| |||||| |||| 3' gcuua ca u uucucucg aggua cuguca uuag a - aua gu uua - uaaug cc |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
miR-281 was reported independently in references [1] and [2]. The sequence in this entry is from reference [2] which identified a 23 nt excised sequence from the 3' arm of the precursor by cloning. Reference [1] reported the reverse complement of this foldback precursor from computational prediction and northern blotting. The predicted mature sequence (5' and 3' ends unknown) from the 3' arm of the reverse complement was named miR-281b in reference [1] and is designated miR-281-2* here. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence dme-miR-281-2-5p |
|
Accession | MIMAT0000349 |
Previous IDs | dme-miR-281-2* |
Sequence |
15 - aagagagcuauccgucgacagu - 36 |
Deep sequencing | 2167282 reads, 49 experiments |
Evidence | experimental; Northern [1], 454 [3-4], Illumina [4] |
Database links |
|
Predicted targets |
|
Mature sequence dme-miR-281-3p |
|
Accession | MIMAT0000345 |
Previous IDs | dme-miR-281 |
Sequence |
60 - ugucauggaauugcucucuuugu - 82 |
Deep sequencing | 405024 reads, 49 experiments |
Evidence | experimental; Northern [1], cloned [2], 454 [3-4], Illumina [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12844358
"Computational identification of Drosophila microRNA genes"
Genome Biol. 4:R42(2003).
|
2 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
3 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
4 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|