Stem-loop sequence dme-mir-281-2

Accession

MI0000370 (change log)

Description

Drosophila melanogaster miR-281-2 stem-loop

Gene family

MIPF0000087; mir-46

Literature search

13 open access papers mention dme-mir-281-2
(27 sentences)

Stem-loop

        u  gaa ug        -ua     c      ---ca    aa 
5' cgaau gu   a  aagagagc   uccgu gacagu     aguu  g
   ||||| ||   |  ||||||||   ||||| ||||||     ||||   
3' gcuua ca   u  uucucucg   aggua cuguca     uuag  a
        -  aua gu        uua     -      uaaug    cc 

Deep sequencing

2370130 reads, 1.25e+04 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-281 was reported independently in references [1] and [2]. The sequence in this entry is from reference [2] which identified a 23 nt excised sequence from the 3' arm of the precursor by cloning. Reference [1] reported the reverse complement of this foldback precursor from computational prediction and northern blotting. The predicted mature sequence (5' and 3' ends unknown) from the 3' arm of the reverse complement was named miR-281b in reference [1] and is designated miR-281-2* here.

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr2R: 12170153-12170244 [-]
• Overlapping transcripts:

  sense

  FBtr0088013 ; Oda-RA; intron 1

  FBtr0088014 ; Oda-RC; intron 1

Clustered miRNAs

< 10kb from dme-mir-281-2

• dme-mir-281-1: chr2R: 12170373-12170462 [-]
• dme-mir-281-2: chr2R: 12170153-12170244 [-]

Database links

• RNAcentral:URS00004A586F_7227
• miRBase Tracker:MI0000370

Mature sequence dme-miR-281-2-5p

• Accession: MIMAT0000349
• Previous IDs: dme-miR-281-2*
• Sequence: 15 - aagagagcuauccgucgacagu - 36
• Deep sequencing: 2167282 reads, 49 experiments
• Evidence: experimental; Northern [1], 454 [3-4], Illumina [4]
• Database links:
  • RNAcentral:URS000050FEA6_7227
• Predicted targets:
  • microrna.org:dme-miR-281-2-5p

Mature sequence dme-miR-281-3p

• Accession: MIMAT0000345
• Previous IDs: dme-miR-281
• Sequence: 60 - ugucauggaauugcucucuuugu - 82
• Deep sequencing: 405024 reads, 49 experiments
• Evidence: experimental; Northern [1], cloned [2], 454 [3-4], Illumina [4]
• Database links:
  • RNAcentral:URS00003C0D23_7227
• Predicted targets:
  • microrna.org:dme-miR-281-3p

References

1. PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).