Stem-loop sequence dme-mir-282

AccessionMI0000367 (change log)
DescriptionDrosophila melanogaster miR-282 stem-loop
Gene family MIPF0000150; mir-282
Literature search

6 open access papers mention dme-mir-282
(23 sentences)

Stem-loop 
   a    -    -cuaa           ac      u      ugcau   a 
5'  guuu ccuu     aucuagccucu  uaggcu ugucug     ucg a
    |||| ||||     |||||||||||  |||||| ||||||     ||| a
3'  caag ggaa     uggauuggaga  auccga acagac     agc g
   a    c    ccaug           au      u      ----u   c
Get sequence
Deep sequencing
290282 reads, 1.18e+04 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 3251022-3251118 [+]
sense
FBtr0309982 ; CR43626-RA; exon 1
Database links

Mature sequence dme-miR-282-5p

Accession MIMAT0000346
Previous IDsdme-miR-282
Sequence

17 -  

uagccucuacuaggcuuugucugu

 - 40

Get sequence
Deep sequencing215568 reads, 49 experiments
Evidence experimental; Northern [1], 454 [2-3], Illumina [3]
Database links
Predicted targets

Mature sequence dme-miR-282-3p

Accession MIMAT0020809
Sequence

60 -  

acauagccuauaagagguuagg

 - 81

Get sequence
Deep sequencing74598 reads, 49 experiments
Evidence not experimental
Database links

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).