Stem-loop sequence dme-mir-133

Accession

MI0000362 (change log)

Description

Drosophila melanogaster miR-133 stem-loop

Gene family

MIPF0000029; mir-133

Literature search

17 open access papers mention dme-mir-133
(59 sentences)

Stem-loop

   ---accug    -    ug             cauc  gu     -  guu 
5'         caac acug  uguagcugguuga    gg  cagau cu   u
           |||| ||||  |||||||||||||    ||  ||||| ||    
3'         guug ugac  augucgaccaacu    cc  guuua ga   u
   caacagua    g    cg             -ucc  ug     c  acu 

Deep sequencing

94819 reads, 1.3e+03 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-133 was reported independently by three groups using computational prediction [2], Northern blot analysis [1] and cloning [3]. References [1] and [2] confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [3] confirmed the ends of the excised miRNA by cloning.

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr2L: 20616617-20616714 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from dme-mir-133

• dme-mir-133: chr2L: 20616617-20616714 [+]
• dme-mir-288: chr2L: 20618366-20618462 [-]

Database links

• RNAcentral:URS000044FBAD_7227
• miRBase Tracker:MI0000362

Mature sequence dme-miR-133-5p

• Accession: MIMAT0020806
• Sequence: 19 - agcugguugacaucgggucagau - 41
• Deep sequencing: 1375 reads, 42 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS000053C538_7227

Mature sequence dme-miR-133-3p

• Accession: MIMAT0000340
• Previous IDs: dme-miR-133
• Sequence: 57 - uugguccccuucaaccagcugu - 78
• Deep sequencing: 93440 reads, 49 experiments
• Evidence: experimental; Northern [1,3], 454 [4-5], Illumina [5]
• Database links:
  • RNAcentral:URS00004883E0_7227
• Predicted targets:
  • TargetScanFly:dme-miR-133
  • microrna.org:dme-miR-133-3p

References

1. PMID:12812784 "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity" Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V Dev Biol. 259:9-18(2003).
2. PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).