Stem-loop sequence dme-mir-278

Accession

MI0000361 (change log)

Description

Drosophila melanogaster miR-278 stem-loop

Gene family

MIPF0000155; mir-278

Literature search

6 open access papers mention dme-mir-278
(13 sentences)

Stem-loop

   -------gu      acgg     c       u     a  a     g   ca 
5'          aauggu    ugcga cggauga gguuc ca cgacc ugu  u
            ||||||    ||||| ||||||| ||||| || ||||| |||  u
3'          uuaccg    auguu gccugcu ucagg gu gcugg gca  u
   agcaacugu      --ca     u       u     -  g     -   aa 

Deep sequencing

135269 reads, 3.21e+03 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-278 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the 5' end of the excised miRNA by cloning and reported a length distribution of 20-22 nt with 22 nt the most commonly expressed.

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr2R: 15657066-15657163 [+]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS000064AEE1_7227
• miRBase Tracker:MI0000361

Mature sequence dme-miR-278-5p

• Accession: MIMAT0020805
• Sequence: 18 - ccggaugaugguucacaacgacc - 40
• Deep sequencing: 22580 reads, 47 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS00004D5D33_7227

Mature sequence dme-miR-278-3p

• Accession: MIMAT0000339
• Previous IDs: dme-miR-278
• Sequence: 57 - ucggugggacuuucguccguuu - 78
• Deep sequencing: 112667 reads, 49 experiments
• Evidence: experimental; Northern [1-2], cloned [2], 454 [3-4], Illumina [4]
• Database links:
  • RNAcentral:URS000044F6FB_7227
• Predicted targets:
  • TargetScanFly:dme-miR-278
  • microrna.org:dme-miR-278-3p

References

1. PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).