Stem-loop sequence dme-mir-219

Accession

MI0000358 (change log)

Description

Drosophila melanogaster miR-219 stem-loop

Gene family

MIPF0000044; mir-219

Literature search

6 open access papers mention dme-mir-219
(7 sentences)

Stem-loop

   ---ua    -g     u   ua    u     aa           ----   a 
5'      auuc  auuuu agc  ugau gucca  cgcaauucuug    uug u
        ||||  ||||| |||  |||| |||||  |||||||||||    ||| a
3'      uaag  uaaag ucg  gcua cgggu  gcguugggaac    aac u
   caaca    aa     c   gc    -     ca           uuau   u 

Deep sequencing

5931 reads, 154 reads per million, 46 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This sequence is computationally predicted based on conservation in D. pseudoobscura [1]. The sequence of the excised miR is strikingly conserved in human (MI0000296), but the expression of the miR has not been confirmed in fly and the precise 5' or 3' ends are unknown.

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr3L: 17315006-17315105 [+]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS0000459EC3_7227
• miRBase Tracker:MI0000358

Mature sequence dme-miR-219-5p

• Accession: MIMAT0000335
• Previous IDs: dme-miR-219
• Sequence: 19 - ugauuguccaaacgcaauucu - 39
• Deep sequencing: 5816 reads, 46 experiments
• Evidence: experimental; 454 [2-3], Illumina [3]
• Database links:
  • RNAcentral:URS0000565C8D_7227
• Predicted targets:
  • TargetScanFly:dme-miR-219
  • microrna.org:dme-miR-219-5p

Mature sequence dme-miR-219-3p

• Accession: MIMAT0020803
• Sequence: 59 - aggguugcgacugggcaucgcg - 80
• Deep sequencing: 114 reads, 33 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS00001C7C00_7227

References

1. PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).