miRBase entry: cel-mir-248

Stem-loop cel-mir-248


Accession
MI0000324
Description
Caenorhabditis elegans cel-mir-248 precursor miRNA
Gene family
MIPF0000262; mir-248

Literature search
2 open access papers mention cel-mir-248
(12 sentences)

Sequence

47061 reads, 271 reads per million, 16 experiments
uuucccggcugcaacuacgguaagcgguauccagccgauguuuucaauacugcauuugaAUACACGUGCACGGAUAACGCUCAuuguuuuucgcaugc
.......(((((((..(((((.((((.(((((.((((.(((.(((((........))))).))))).))..))))).)))).)))))..)).))).))

Structure
uuucccg  -   -  cu     a    g     -a  -  a   u     uac 
       gc ugc aa  acggu agcg uaucc  gc cg ugu uucaa   u
       || ||| ||  ||||| |||| |||||  || || ||| |||||    
       cg acg uu  uguuA UCGC AUAGG  CG GC ACA Aaguu   g
-------  u   c  uu     C    A     CA  U  -   U     uac 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [2].

Genome context
chrX: 2262373-2262470 [-]

Database links

Mature cel-miR-248

Accession MIMAT0000304
Description Caenorhabditis elegans cel-miR-248 mature miRNA
Sequence 60 - AUACACGUGCACGGAUAACGCUCA - 83
Evidence experimental
cloned [1-2], Northern [1], Illumina [3], CLIPseq [4]
Database links
Predicted targets

References

  1. PubMed ID: 12672692
    The microRNAs of Caenorhabditis elegans
    "Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP"
    "Genes Dev (2003) 17:991-1008

  2. PubMed ID: 17174894
    Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans
    "Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP"
    "Cell (2006) 127:1193-1207

  3. PubMed ID: 19460142
    Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
    Kato M, de Lencastre A, Pincus Z, Slack FJ
    Genome Biol (2009) 10:R54

  4. PubMed ID: 20062054
    Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans
    "Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW"
    "Nat Struct Mol Biol (2010) 17:173-179