![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-222 |
||||||
Accession | MI0000299 (change log) | |||||
Symbol | HGNC:MIR222 | |||||
Description | Homo sapiens miR-222 stem-loop | |||||
Gene family | MIPF0000051; mir-221 | |||||
Literature search |
![]()
396 open access papers mention hsa-mir-222 | |||||
Stem-loop |
gcu uaggua c au - auc ucuu 5' gcuggaaggug cc uca ggcucaguagccag uguag cug u ||||||||||| || ||| |||||||||||||| ||||| ||| c 3' cgaucuucuac gg agu cugggucaucgguc acauc gac g --u ------ u cu u gac uaau |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR was validated in zebrafish, and the ends mapped by cloning. Subsequent cloning studies have also verified the expression of miR-222 in human ES cells. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-222-5p |
|
Accession | MIMAT0004569 |
Previous IDs | hsa-miR-222* |
Sequence |
31 - cucaguagccaguguagauccu - 52 |
Deep sequencing | 5479 reads, 129 experiments |
Evidence | experimental; cloned [4] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-222-3p |
|
Accession | MIMAT0000279 |
Previous IDs | hsa-miR-222 |
Sequence |
69 - agcuacaucuggcuacugggu - 89 |
Deep sequencing | 1576244 reads, 159 experiments |
Evidence | experimental; cloned [2-5], Northern [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
2 |
PMID:15183728
"Human embryonic stem cells express a unique set of microRNAs"
Dev Biol. 270:488-498(2004).
|
3 |
PMID:15325244
"Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
Biochem Biophys Res Commun. 322:403-410(2004).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|