Stem-loop sequence hsa-mir-222

Accession

MI0000299 (change log)

Symbol

HGNC:MIR222

Description

Homo sapiens miR-222 stem-loop

Gene family

MIPF0000051; mir-221

Literature search

396 open access papers mention hsa-mir-222
(2003 sentences)

Stem-loop

   gcu           uaggua  c   au              -     auc   ucuu 
5'    gcuggaaggug      cc uca  ggcucaguagccag uguag   cug    u
      |||||||||||      || |||  |||||||||||||| |||||   |||    c
3'    cgaucuucuac      gg agu  cugggucaucgguc acauc   gac    g
   --u           ------  u   cu              u     gac   uaau 

Deep sequencing

1581861 reads, 3.52e+03 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR was validated in zebrafish, and the ends mapped by cloning. Subsequent cloning studies have also verified the expression of miR-222 in human ES cells. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chrX: 45747015-45747124 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-222

• hsa-mir-222: chrX: 45747015-45747124 [-]
• hsa-mir-221: chrX: 45746157-45746266 [-]

Database links

• EntrezGene:MIR222
• HGNC:MIR222
• RNAcentral:URS000075C381_9606
• miRBase Tracker:MI0000299

Mature sequence hsa-miR-222-5p

• Accession: MIMAT0004569
• Previous IDs: hsa-miR-222*
• Sequence: 31 - cucaguagccaguguagauccu - 52
• Deep sequencing: 5479 reads, 129 experiments
• Evidence: experimental; cloned [4]
• Database links:
  • RNAcentral:URS0000153377_9606
• Predicted targets:
  • TargetMiner:hsa-miR-222-5p
  • TargetScanVert:hsa-miR-222-5p
  • miRDB:hsa-miR-222-5p
  • microrna.org:hsa-miR-222-5p

Mature sequence hsa-miR-222-3p

• Accession: MIMAT0000279
• Previous IDs: hsa-miR-222
• Sequence: 69 - agcuacaucuggcuacugggu - 89
• Deep sequencing: 1576244 reads, 159 experiments
• Evidence: experimental; cloned [2-5], Northern [2]
• Database links:
  • RNAcentral:URS00002C6949_9606
• Predicted targets:
  • TargetMiner:hsa-miR-222-3p
  • TargetScanVert:hsa-miR-222-3p
  • miRDB:hsa-miR-222-3p
  • microrna.org:hsa-miR-222-3p

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).