Stem-loop sequence hsa-mir-199a-2

Accession

MI0000281 (change log)

Symbol

HGNC:MIR199A2

Description

Homo sapiens miR-199a-2 stem-loop

Gene family

MIPF0000040; mir-199

Literature search

379 open access papers mention hsa-mir-199a-2
(2572 sentences)

Stem-loop

   aggaa   u  ggaga    -    c   gcc       u        c   --uca  ac 
5'      gcu cu     uccu gcuc guc   ccagugu cagacuac ugu     gg  a
        ||| ||     |||| |||| |||   ||||||| |||||||| |||     ||   
3'      cga ga     ggga cggg cag   gguuaca gucugaug aca     cc  a
   ----a   -  -----    a    u   auu       c        -   uguug  gu 

Deep sequencing

5925367 reads, 1.02e+04 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Lagos-Quintana et al. [1] cloned miR-199 from human osteoblast sarcoma cells. They also reported identification of a miRNA from the opposite arm in mouse cells. This sequence was named miR-199-s and the sequence from the 3' arm of the homologous mouse precursor miR-199-as. Lim et al. [2] independently predicted this miRNA computationally using conservation with mouse and Fugu rubripes sequences [2]. Expression of the miR excised from the 5' arm was validated in zebrafish, and the ends mapped by cloning. The excised miR sequences are renamed miR-199a (to avoid confusion with the subsequently identified miR-199b (MI0000282)) and miR-199a* (from the 3' arm) here. The two putative hairpin precursors in human map to chromosome 19 (mir-199a-1, MI0000242) and chromosome 1 (mir-199a-2, MI0000281). Landgraf et al. show that both mature products are expressed, prompting the renaming to miR-199a-5p and miR-199a-3p [4].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr1: 172144535-172144644 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000378444 ; DNM3-008; intron 13

  OTTHUMT00000084529 ; DNM3-001; intron 14

  OTTHUMT00000378443 ; DNM3-007; intron 14

  OTTHUMT00000084531 ; DNM3-003; intron 15

  ENST00000523513 ; DNM3-008; intron 13

  ENST00000367731 ; DNM3-001; intron 14

  ENST00000520906 ; DNM3-007; intron 14

  ENST00000358155 ; DNM3-201; intron 14

  ENST00000355305 ; DNM3-003; intron 15

Clustered miRNAs

< 10kb from hsa-mir-199a-2

• hsa-mir-199a-2: chr1: 172144535-172144644 [-]
• hsa-mir-3120: chr1: 172138808-172138888 [+]
• hsa-mir-214: chr1: 172138798-172138907 [-]

Database links

• EntrezGene:MIR199A2
• HGNC:MIR199A2
• RNAcentral:URS000043F622_9606
• miRBase Tracker:MI0000281

Mature sequence hsa-miR-199a-5p

• Accession: MIMAT0000231
• Previous IDs: hsa-miR-199a
• Sequence: 31 - cccaguguucagacuaccuguuc - 53
• Deep sequencing: 1830012 reads, 149 experiments
• Evidence: experimental; cloned [2-4]
• Database links:
  • RNAcentral:URS0000554A4F_9606
• Predicted targets:
  • TargetMiner:hsa-miR-199a-5p
  • TargetScanVert:hsa-miR-199a-5p
  • miRDB:hsa-miR-199a-5p
  • microrna.org:hsa-miR-199a-5p

Mature sequence hsa-miR-199a-3p

• Accession: MIMAT0000232
• Previous IDs: hsa-miR-199a*
• Sequence: 70 - acaguagucugcacauugguua - 91
• Deep sequencing: 9969596 reads, 159 experiments
• Evidence: experimental; cloned [4], Illumina [5]
• Database links:
  • RNAcentral:URS00003F2D94_9606
• Predicted targets:
  • TargetMiner:hsa-miR-199a-3p
  • TargetScanVert:hsa-miR-199a-3p
  • miRDB:hsa-miR-199a-3p
  • microrna.org:hsa-miR-199a-3p

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
3. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).