![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-183 |
||||||||
Accession | MI0000273 (change log) | |||||||
Symbol | HGNC:MIR183 | |||||||
Description | Homo sapiens miR-183 stem-loop | |||||||
Gene family | MIPF0000066; mir-183 | |||||||
Literature search |
![]()
202 open access papers mention hsa-mir-183 | |||||||
Stem-loop |
ccgcaga u ---c - g --ac ga -- ac 5' gug ga uc cuguucugu uauggc uggua auucacug uga a ||| || || ||||||||| |||||| ||||| |||||||| ||| 3' cac cu ag gacgagaca auaccg gccau uaagugac acu g -----ag - agac a a ggaa -- ug cu |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Comments |
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Expression was later confirmed in human [2,3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence hsa-miR-183-5p |
|
Accession | MIMAT0000261 |
Previous IDs | hsa-miR-183 |
Sequence |
27 - uauggcacugguagaauucacu - 48 |
Deep sequencing | 277729 reads, 151 experiments |
Evidence | experimental; cloned [2-4] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-183-3p |
|
Accession | MIMAT0004560 |
Previous IDs | hsa-miR-183* |
Sequence |
66 - gugaauuaccgaagggccauaa - 87 |
Deep sequencing | 4094 reads, 120 experiments |
Evidence | experimental; cloned [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
2 |
PMID:12554860
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|