miRBase entry: hsa-mir-181a-2

Stem-loop hsa-mir-181a-2


Accession
MI0000269
Symbol
HGNC: MIR181A2
Description
Homo sapiens hsa-mir-181a-2 precursor miRNA
Gene family
MIPF0000007; mir-181

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR181A2 is a microRNA that can be transcribed from two different genes, MIR181A1 and MIR181A2, and is regulated by multiple transcription factors and enhancer/promoter regions [PMC8979821]. Overexpression of MIR181A2 has been associated with various types of cancer [PMC6781644]. In a hyperglycemic state, the lncRNA MIR181A2 is downregulated, leading to an increase in the concentration of certain microRNAs [PMC9430013]. Overexpression of MIR181A2 has been shown to downregulate PCAF mRNA and protein levels [PMC5573355]. The downregulation of MIR181A2 by HIV vEnv glycoprotein is associated with enhanced viral transcription and infectivity [PMC5573355]. Lentiviral particles expressing MIR181A2 have been used to transduce T cells, resulting in reduced HIV transcription [PMC5573355]. The downregulation of MIR181A2 may be a natural host mechanism targeted by HIV to activate viral transcription [PMC5573355]. The host gene for MIR181A2, known as MIR181A2HG, has been found to be overexpressed in the thyroid but its function remains unknown [PMC6380385]. The expression levels of AKT2 have been investigated as potential targets for miR-181-3p and miR-181-5p derived from the host gene MIR18IAHG [PMC7891834]. In various tissues, including the human body's nucleus, the host gene for MIRA18IAHG is expressed [PMC10111190]. In different studies, miR-18IAHG has shown potential as a biomarker for certain diseases such as diabetes and cancer but its function remains unclear in these contexts.

Literature search
487 open access papers mention hsa-mir-181a-2
(2580 sentences)

Sequence

2190059 reads, 4211 reads per million, 140 experiments
agaagggcuaucaggccagccuucagaggacuccaaggAACAUUCAACGCUGUCGGUGAGUuugggauuugaaaaaACCACUGACCGUUGACUGUACCuugggguccuua
.((((((((....)))...))))).(((((((((((((.(((.((((((..(((((((.((((...........))))))))))))))))).))).))))))))))))).

Structure
agaagggcuaucaggccagccuuca             A   U      CU       A    ggga 
                         gaggacuccaagg ACA UCAACG  GUCGGUG GUuu    u
                         ||||||||||||| ||| ||||||  ||||||| ||||    u
                         uuccugggguuCC UGU AGUUGC  CAGUCAC CAaa    u
------------------------a             A   C      --       -    aaag 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. and Lui et al. later verify expression in human [4-5].

Genome context
chr9: 124692442-124692551 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-181a-2
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-181a-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-181a-5p

Accession MIMAT0000256
Description Homo sapiens hsa-miR-181a-5p mature miRNA
Sequence 39 - AACAUUCAACGCUGUCGGUGAGU - 61
Evidence experimental
cloned [2,4-6]
Database links
Predicted targets

Mature hsa-miR-181a-2-3p

Accession MIMAT0004558
Description Homo sapiens hsa-miR-181a-2-3p mature miRNA
Sequence 77 - ACCACUGACCGUUGACUGUACC - 98
Evidence experimental
cloned [4]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 17989717
    Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis
    "Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A"
    "Leukemia (2008) 22:330-338

  5. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73