MIR7-1 is a microRNA precursor that is generated from HNRNPK intron 15 [PMC4647676]. Further research is needed to understand the genetic regulation and expression of MIR7-1, as well as its role in metabolic traits [PMC9522793]. MIR7-1 is located in the last intron of the HNRNPK gene, and its expression is driven by the promoter of HNRNPK [PMC9522793]. The transcription factor FOXP3 positively regulates miR-7 expression in breast cancer [PMC4600152]. miR-7 can be expressed from three loci in humans, including MIR7-1 [PMC4600152]. The exact mechanism of miR-7 stimulation via the PI3K/Akt pathway is still unknown, but c-Myc has been found to directly bind and stimulate expression from the MIR7-1 promoter [PMC4600152]. Other transcription factors, such as HOXD10 and HNF4α, have also been involved in promoting miR-7 expression via interaction with the promoter regions of miR-7 genes including MIR7-1 [PMC4600152]. MIR7-1 is believed to be the most highly expressed source of mature miR-7 and is located within the hnRNPK gene on chromosome 9 [PMC4600152]. In addition to its role in breast cancer, MIR7-1 has also been implicated in other diseases such as neurodegenerative alterations and metabolic alterations [PMC9571148].
--u u - a u A A U -- a ugga gu uggccu gu cugugUGG AGACU GUGAUUU GUUGUU uuuag u |||| || |||||| || |||||||| ||||| ||||||| |||||| ||||| aucu cg accgga ca gguAUACC UCUGA CACUAAA CAACag aaauc a gac c u - c G - - cu a
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000252 |
Description | Homo sapiens hsa-miR-7-5p mature miRNA |
Sequence | 24 - UGGAAGACUAGUGAUUUUGUUGUU - 47 |
Evidence |
experimental
cloned [2-3] |
Database links | |
Predicted targets |
Accession | MIMAT0004553 |
Description | Homo sapiens hsa-miR-7-1-3p mature miRNA |
Sequence | 66 - CAACAAAUCACAGUCUGCCAUA - 87 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
|