Stem-loop sequence mmu-mir-202

AccessionMI0000245 (change log)
Symbol MGI:Mir202
DescriptionMus musculus miR-202 stem-loop
Gene family MIPF0000121; mir-202
Literature search

19 open access papers mention mmu-mir-202
(76 sentences)

Stem-loop
        u           -a          ug       
5' guucc uuuuccuaugc  uauacuucuu  uggauc 
   ||||| |||||||||||  ||||||||||  ||||| u
3' cgagg agaaggguacg  auauggagaa  aucugg 
        u           cg          --       
Get sequence
Deep sequencing
196373 reads, 635 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 139957689-139957760 [-]
sense
OTTMUST00000078514 ; AC107822.6-001; exon 2
ENSMUST00000130771 ; Gm2044-001; exon 2
antisense
OTTMUST00000078515 ; AC107822.5-001; intron 1
OTTMUST00000078516 ; AC107822.5-002; intron 3
ENSMUST00000139218 ; Gm16201-001; intron 1
ENSMUST00000134312 ; Gm16201-002; intron 3
Clustered miRNAs
< 10kb from mmu-mir-202
mmu-mir-202chr7: 139957689-139957760 [-]
mmu-mir-7686chr7: 139957566-139957622 [-]
Database links

Mature sequence mmu-miR-202-5p

Accession MIMAT0004546
Sequence

9 - 

uuccuaugcauauacuucuuu

 - 29

Get sequence
Deep sequencing186178 reads, 40 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-202-3p

Accession MIMAT0000235
Previous IDsmmu-miR-202
Sequence

45 - 

agagguauagcgcaugggaaga

 - 66

Get sequence
Deep sequencing10176 reads, 38 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).