MIR196A1 is a member of the MIR196 gene family, which includes MIR196A1, MIR196A2, and MIR196B. It is a noncoding RNA derived from the HOXB gene cluster on chromosome 17 in humans. [PMC4413621]. Studies have identified MIR196A1 as a potential biomarker for several diseases, including hepatocellular carcinoma, leukemia, lung cancer, breast cancer, colorectal cancer, and pancreatic adenocarcinoma [PMC10134363]. The expression of MIR196A1 can be influenced by genetic variations and is correlated with HOXB7 and HOXB8 expression [PMC5551414]. It has also been associated with adipogenesis and body fat distribution [PMC5551414]. The miR-196 family includes miR-196a-2 (encoded by MIR196A2) and miR-196b (encoded by MIR196B), which share identical seed sequences with miR-196a1 [PMC6080909]. Aberrant methylation of the CpG sites in the RUNX3 and MIR196A1 genes has been observed in relation to smoking cessation [PMC5960087]. Additionally, the combination of VAT1L, CALR, LINC01456, RP11-484L8.1, MIR148A, and MIR 19 6 A 1 has been associated with overall survival in pancreatic cancer patients [PMC5641173]. Overall,MIR19 6 A 1 plays a role in various diseases as a potential biomarker or regulator of gene expression.
A A C - Gc ugg gugaauU GGU GUUU AUGUUGUUG G c g ||||||| ||| |||| ||||||||| | | u cacuuAG CCA CAAA UACAACAAC c g u C C U a aa ucu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000226 |
Description | Homo sapiens hsa-miR-196a-5p mature miRNA |
Sequence | 7 - UAGGUAGUUUCAUGUUGUUGGG - 28 |
Evidence |
experimental
cloned [3-5] |
Database links | |
Predicted targets |
Accession | MIMAT0037307 |
Description | Homo sapiens hsa-miR-196a-1-3p mature miRNA |
Sequence | 45 - CAACAACAUUAAACCACCCGA - 65 |
Evidence | not_experimental |
|