Stem-loop mmu-mir-191

Accession

MI0000233

Symbol

MGI: Mir191

Description

Mus musculus mmu-mir-191 precursor miRNA

Gene family

MIPF0000194; mir-191

Literature search

61 open access papers mention mmu-mir-191
(162 sentences)

Sequence

3770579 reads, 12102 reads per million, 122 experiments

agcgggCAACGGAAUCCCAAAAGCAGCUGuugucuccagagcauuccaGCUGCACUUGGAUUUCGUUCCCugcu
((((((.((((((((((.((..(((((((.(((.......)))...)))))))..)))))))))))).))))))

Structure

      C          C  AA       --u   cu 
agcggg AACGGAAUCC AA  GCAGCUG   ugu  c
|||||| |||||||||| ||  |||||||   |||  c
ucguCC UUGCUUUAGG UU  CGUCGac   acg  a
      C          -  CA       cuu   ag 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

chr9: 108568319-108568392 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from mmu-mir-191

Mature mmu-miR-191-5p

• Accession: MIMAT0000221
• Description: Mus musculus mmu-miR-191-5p mature miRNA
• Sequence: 7 - CAACGGAAUCCCAAAAGCAGCUG - 29
• Evidence: experimental ; cloned [1-4], Illumina [5-6]

Mature mmu-miR-191-3p

• Accession: MIMAT0004542
• Description: Mus musculus mmu-miR-191-3p mature miRNA
• Sequence: 49 - GCUGCACUUGGAUUUCGUUCCC - 70
• Evidence: experimental ; cloned [4], Illumina [5-6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12554859
   New microRNAs from mouse and human
   "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
   "RNA (2003) 9:175-179


3. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


4. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


5. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


6. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009