![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-191 |
||||||
Accession | MI0000233 (change log) | |||||
Symbol | MGI:Mir191 | |||||
Description | Mus musculus miR-191 stem-loop | |||||
Gene family | MIPF0000194; mir-191 | |||||
Literature search |
![]()
61 open access papers mention mmu-mir-191 | |||||
Stem-loop |
c c aa uu - c 5' agcggg aacggaaucc aa gcagcug gu cu c |||||| |||||||||| || ||||||| || || 3' ucgucc uugcuuuagg uu cgucgac ua ga a c - ca cu c g |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-191-5p |
|
Accession | MIMAT0000221 |
Previous IDs | mmu-miR-191 |
Sequence |
7 - caacggaaucccaaaagcagcug - 29 |
Deep sequencing | 4502528 reads, 107 experiments |
Evidence | experimental; cloned [1-4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-191-3p |
|
Accession | MIMAT0004542 |
Previous IDs | mmu-miR-191* |
Sequence |
49 - gcugcacuuggauuucguuccc - 70 |
Deep sequencing | 4748 reads, 98 experiments |
Evidence | experimental; cloned [4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 | |
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|