Stem-loop sequence mmu-mir-188

AccessionMI0000230 (change log)
Symbol MGI:Mir188
DescriptionMus musculus miR-188 stem-loop
Gene family MIPF0000113; mir-188
Literature search

36 open access papers mention mmu-mir-188
(256 sentences)

Stem-loop
      ca  uc         gu      -ugag u 
5' ucu  ca  ccuugcaug  ggaggg     c c
   |||  ||  |||||||||  ||||||     | u
3' agg  gu  gggacguac  ccuccc     g c
      ac  uu         ac      caaaa u 
Get sequence
Deep sequencing
7851 reads, 25.5 reads per million, 98 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 7247989-7248056 [-]
sense
OTTMUST00000039775 ; Clcn5-003; intron 2
OTTMUST00000039776 ; Clcn5-004; intron 3
OTTMUST00000039777 ; Clcn5-005; intron 3
ENSMUST00000128319 ; Clcn5-003; intron 2
ENSMUST00000115746 ; Clcn5-004; intron 3
ENSMUST00000132126 ; Clcn5-005; intron 3
Clustered miRNAs
< 10kb from mmu-mir-188
mmu-mir-532chrX: 7248402-7248497 [-]
mmu-mir-188chrX: 7247989-7248056 [-]
mmu-mir-362chrX: 7241982-7242046 [-]
mmu-mir-501chrX: 7241243-7241351 [-]
Database links

Mature sequence mmu-miR-188-5p

Accession MIMAT0000217
Previous IDsmmu-miR-188
Sequence

6 - 

caucccuugcaugguggaggg

 - 26

Get sequence
Deep sequencing6931 reads, 96 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-188-3p

Accession MIMAT0004541
Sequence

45 - 

cucccacaugcaggguuugca

 - 65

Get sequence
Deep sequencing875 reads, 71 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).