![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-188 |
||||||||||
Accession | MI0000230 (change log) | |||||||||
Symbol | MGI:Mir188 | |||||||||
Description | Mus musculus miR-188 stem-loop | |||||||||
Gene family | MIPF0000113; mir-188 | |||||||||
Literature search |
![]()
36 open access papers mention mmu-mir-188 | |||||||||
Stem-loop |
ca uc gu -ugag u 5' ucu ca ccuugcaug ggaggg c c ||| || ||||||||| |||||| | u 3' agg gu gggacguac ccuccc g c ac uu ac caaaa u |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: high
| |||||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
|||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
|
Mature sequence mmu-miR-188-5p |
|
Accession | MIMAT0000217 |
Previous IDs | mmu-miR-188 |
Sequence |
6 - caucccuugcaugguggaggg - 26 |
Deep sequencing | 6931 reads, 96 experiments |
Evidence | experimental; cloned [1-3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-188-3p |
|
Accession | MIMAT0004541 |
Sequence |
45 - cucccacaugcaggguuugca - 65 |
Deep sequencing | 875 reads, 71 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|