Stem-loop sequence mmu-mir-185

AccessionMI0000227 (change log)
Symbol MGI:Mir185
DescriptionMus musculus miR-185 stem-loop
Gene family MIPF0000202; mir-185
Literature search

36 open access papers mention mmu-mir-185
(224 sentences)

Stem-loop
         ug   a     g         au  uc 
5' agggau  gag gaaag caguuccug  gg  c
   ||||||  ||| ||||| |||||||||  ||   
3' uuccug  cuc cuuuc gucggggac  cc  c
         gu   -     g         --  uc 
Get sequence
Deep sequencing
603093 reads, 1.26e+03 reads per million, 105 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 18327401-18327465 [-]
sense
OTTMUST00000064221 ; RP23-47O21.5-001; intron 1
OTTMUST00000064224 ; RP23-47O21.5-004; intron 1
OTTMUST00000064868 ; RP23-47O21.5-010; intron 1
OTTMUST00000064223 ; RP23-47O21.5-003; intron 1
ENSMUST00000115628 ; Tango2-001; intron 1
ENSMUST00000125287 ; Tango2-004; intron 1
ENSMUST00000130752 ; Tango2-010; intron 1
ENSMUST00000134385 ; Tango2-003; intron 1
ENSMUST00000083530 ; Mir185-201; exon 1
Database links

Mature sequence mmu-miR-185-5p

Accession MIMAT0000214
Previous IDsmmu-miR-185
Sequence

7 - 

uggagagaaaggcaguuccuga

 - 28

Get sequence
Deep sequencing600847 reads, 105 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-185-3p

Accession MIMAT0016996
Previous IDsmmu-miR-185*
Sequence

41 - 

aggggcuggcuuuccucuggu

 - 61

Get sequence
Deep sequencing2246 reads, 96 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).