![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-181a-2 |
||||||
Accession | MI0000223 (change log) | |||||
Previous IDs | mmu-mir-181;mmu-mir-181a | |||||
Symbol | MGI:Mir181a-2 | |||||
Description | Mus musculus miR-181a-2 stem-loop | |||||
Gene family | MIPF0000007; mir-181 | |||||
Literature search |
![]()
206 open access papers mention mmu-mir-181a-2 | |||||
Stem-loop |
u a u cu a gggauuc 5' cca gg aca ucaacg gucggug guuu a ||| || ||| |||||| ||||||| |||| a 3' ggu cc ugu aguugc cagccac caaa a u a c -- - aaaacaa |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-181a-5p |
|
Accession | MIMAT0000210 |
Previous IDs | mmu-miR-181a |
Sequence |
7 - aacauucaacgcugucggugagu - 29 |
Deep sequencing | 10154990 reads, 107 experiments |
Evidence | experimental; cloned [2,4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-181a-2-3p |
|
Accession | MIMAT0005443 |
Previous IDs | mmu-miR-181a-2* |
Sequence |
51 - accaccgaccguugacuguacc - 72 |
Deep sequencing | 64988 reads, 98 experiments |
Evidence | experimental; cloned [5], Illumina [6-7] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
2 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
3 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
4 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
5 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
6 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
7 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|