Stem-loop sequence ath-MIR173

Accession

MI0000217 (change log)

Description

Arabidopsis thaliana miR173 stem-loop

Gene family

MIPF0001175; MIR173

Literature search

15 open access papers mention ath-MIR173
(47 sentences)

Stem-loop

        a            g      a      u  ucaaaaaag   u  u 
5' uaagu cuuucgcuugca agagaa ucacag gg         uug ag u
   ||||| |||||||||||| |||||| |||||| ||         ||| ||  
3' guucg gaaagcgaaugu ucucuu aguguc cc         aau uc u
        a            g      -      u  uuucucuga   -  u 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

MIR173 is thought to target mRNAs coding for a protein of unknown function (At3g28460) [1].

Genome context

• Coordinates (TAIR10; GCA_000001735.1): chr3: 8236153-8236254 [+]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS000079C744_3702
• miRBase Tracker:MI0000217

Mature sequence ath-miR173-5p

• Accession: MIMAT0000206
• Previous IDs: ath-miR173
• Sequence: 9 - uucgcuugcagagagaaaucac - 30
• Evidence: experimental; cloned [1-2], 454 [3-4], MPSS [3], Illumina [5]

Mature sequence ath-miR173-3p

• Accession: MIMAT0022843
• Sequence: 75 - ugauucucuguguaagcgaaa - 95
• Evidence: experimental; Illumina [6]

References

1. PMID:12225663 "CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana" Park W, Li J, Song R, Messing J, Chen X Curr Biol. 12:1484-1495(2002).
2. PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3. PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4. PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5. PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).
6. PMID:22221297 "Global analysis of non-coding small RNAs in Arabidopsis in response to jasmonate treatment by deep sequencing technology" Zhang B, Xie D, Jin Z J Integr Plant Biol. 54:73-86(2012).