Stem-loop sequence ath-MIR160c

Accession

MI0000192 (change log)

Description

Arabidopsis thaliana miR160c stem-loop

Gene family

MIPF0000032; MIR160

Literature search

36 open access papers mention ath-MIR160c
(110 sentences)

Stem-loop

          c       c          ga ug aua         g 
5' guuaugc uggcucc uguaugccac  g  g   ccgauuuug u
   ||||||| ||||||| ||||||||||  |  |   |||||||||  
3' caguacg acugagg acaugcggug  c  c   ggcuaaaau u
          a       a          gc gu ---         u 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

MIR160c is thought to target mRNAs coding for auxin response factor proteins [2].

Genome context

• Coordinates (TAIR10; GCA_000001735.1): chr5: 19009094-19009182 [-]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS00007B746E_3702
• miRBase Tracker:MI0000192

Mature sequence ath-miR160c-5p

• Accession: MIMAT0000180
• Previous IDs: ath-miR160c
• Sequence: 5 - ugccuggcucccuguaugcca - 25
• Evidence: experimental; cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

Mature sequence ath-miR160c-3p

• Accession: MIMAT0031875
• Sequence: 68 - cguacaaggagucaagcauga - 88
• Evidence: experimental; Illumina [7]

References

1. PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2. PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3. PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4. PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5. PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6. PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).
7. PMID:24119003 "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots" Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA BMC Genomics. 14:701(2013).