Stem-loop sequence ath-MIR156d

Accession

MI0000181 (change log)

Description

Arabidopsis thaliana miR156d stem-loop

Gene family

MIPF0000008; MIR156

Literature search

79 open access papers mention ath-MIR156d
(760 sentences)

Stem-loop

   g        aaa     --        -            a      g  agu       a 
5'  auggggga   gaagu  ugacagaa gagagugagcac caaagg ga   uguauaa a
    ||||||||   |||||  |||||||| |||||||||||| |||||| ||   ||||||| g
3'  uacuuccu   cuuca  acuguuuu cucucacucgug guuuuc uu   auauguu u
   -        ---     au        u            c      g  ggu       u 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

MIR156d is thought to target 10 mRNAs coding for proteins containing the Squamosa-promoter Binding Protein (SBP) box [1]. The complementary sites are downstream of this conserved domain, within a poorly conserved protein-coding context or the 3' UTR [2].

Genome context

• Coordinates (TAIR10; GCA_000001735.1): chr5: 3456632-3456749 [-]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS00007B8F19_3702
• Rfam:mir-156
• miRBase Tracker:MI0000181

Mature sequence ath-miR156d-5p

• Accession: MIMAT0000169
• Previous IDs: ath-miR156d
• Sequence: 18 - ugacagaagagagugagcac - 37
• Evidence: experimental; cloned [1,3], Northern [1], 454 [4-5], MPSS [4], Illumina [6]

Mature sequence ath-miR156d-3p

• Accession: MIMAT0031868
• Sequence: 85 - gcucacucucuuuuugucauaac - 107
• Evidence: not experimental

References

1. PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2. PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3. PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4. PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5. PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6. PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).