![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-153 |
|||||
Accession | MI0000175 (change log) | ||||
Symbol | MGI:Mir153 | ||||
Description | Mus musculus miR-153 stem-loop | ||||
Gene family | MIPF0000050; mir-153 | ||||
Literature search |
![]()
32 open access papers mention mmu-mir-153 | ||||
Stem-loop |
- gu -a aa 5' cggug ucauuuuugugac ugcagcu gu u ||||| ||||||||||||| ||||||| || a 3' guuac agugaaaacacug acguuga cg u u au cc ag |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-153-5p |
|
Accession | MIMAT0016992 |
Previous IDs | mmu-miR-153* |
Sequence |
5 - gucauuuuugugacguugcagcu - 27 |
Deep sequencing | 777 reads, 28 experiments |
Evidence | experimental; Illumina [5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-153-3p |
|
Accession | MIMAT0000163 |
Previous IDs | mmu-miR-153 |
Sequence |
44 - uugcauagucacaaaagugauc - 65 |
Deep sequencing | 76353 reads, 47 experiments |
Evidence | experimental; cloned [1-3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|