Stem-loop sequence mmu-mir-149

AccessionMI0000171 (change log)
Symbol MGI:Mir149
DescriptionMus musculus miR-149 stem-loop
Gene family MIPF0000274; mir-149
Literature search

30 open access papers mention mmu-mir-149
(319 sentences)

Stem-loop
      u   g      g     a     g g   g 
5' ggc cug cuccgu ucuuc cuccc u uuu u
   ||| ||| |||||| ||||| ||||| | |||  
3' ucg ggc ggggca ggagg gaggg a gag c
      u   g      g     -     - g   c 
Get sequence
Deep sequencing
66960 reads, 122 reads per million, 95 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 92850378-92850443 [+]
sense
ENSMUST00000045970 ; Gpc1-201; intron 1
Database links

Mature sequence mmu-miR-149-5p

Accession MIMAT0000159
Previous IDsmmu-miR-149
Sequence

4 - 

ucuggcuccgugucuucacuccc

 - 26

Get sequence
Deep sequencing66111 reads, 81 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-149-3p

Accession MIMAT0016990
Previous IDsmmu-miR-149*
Sequence

44 - 

gagggagggacgggggcggugc

 - 65

Get sequence
Deep sequencing246 reads, 59 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).