![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-136 |
||||||||||||||||||||||||||||
Accession | MI0000162 (change log) | |||||||||||||||||||||||||||
Symbol | MGI:Mir136 | |||||||||||||||||||||||||||
Description | Mus musculus miR-136 stem-loop | |||||||||||||||||||||||||||
Gene family | MIPF0000099; mir-136 | |||||||||||||||||||||||||||
Literature search |
![]()
24 open access papers mention mmu-mir-136 | |||||||||||||||||||||||||||
Stem-loop |
c uuu uuc 5' gaggacuc auuug ugaugaugga u |||||||| ||||| |||||||||| u 3' cuucugag uaaac gcuacuaccu a - ucu cga |
|||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
|||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-136-5p |
|
Accession | MIMAT0000148 |
Previous IDs | mmu-miR-136 |
Sequence |
5 - acuccauuuguuuugaugaugg - 26 |
Deep sequencing | 250265 reads, 82 experiments |
Evidence | experimental; cloned [1-2,4], PCR [3], Illumina [5-6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-136-3p |
|
Accession | MIMAT0004532 |
Previous IDs | mmu-miR-136* |
Sequence |
40 - aucaucgucucaaaugagucuu - 61 |
Deep sequencing | 127311 reads, 80 experiments |
Evidence | experimental; cloned [4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 |
PMID:15854907
"RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus"
Curr Biol. 15:743-749(2005).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|