![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-132 |
||||||
Accession | MI0000158 (change log) | |||||
Symbol | MGI:Mir132 | |||||
Description | Mus musculus miR-132 stem-loop | |||||
Gene family | MIPF0000065; mir-132 | |||||
Literature search |
![]()
178 open access papers mention mmu-mir-132 | |||||
Stem-loop |
a uuc -g 5' gggc accguggcu gauuguuacu uggg |||| ||||||||| |||||||||| ||| a 3' cccg ugguaccga cugacaaugg gcca c cau ag |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-132-5p |
|
Accession | MIMAT0016984 |
Previous IDs | mmu-miR-132* |
Sequence |
5 - aaccguggcuuucgauuguuac - 26 |
Deep sequencing | 10315 reads, 89 experiments |
Evidence | experimental; 454 [4], Illumina [5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-132-3p |
|
Accession | MIMAT0000144 |
Previous IDs | mmu-miR-132 |
Sequence |
42 - uaacagucuacagccauggucg - 63 |
Deep sequencing | 147423 reads, 105 experiments |
Evidence | experimental; cloned [1-2], Illumina [3,5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|