Stem-loop sequence mmu-mir-132

Accession

MI0000158 (change log)

Symbol

MGI:Mir132

Description

Mus musculus miR-132 stem-loop

Gene family

MIPF0000065; mir-132

Literature search

178 open access papers mention mmu-mir-132
(1841 sentences)

Stem-loop

       a         uuc          -g     
5' gggc accguggcu   gauuguuacu  uggg 
   |||| |||||||||   ||||||||||  ||| a
3' cccg ugguaccga   cugacaaugg  gcca 
       c         cau          ag     

Deep sequencing

157834 reads, 129 reads per million, 105 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr11: 75173682-75173747 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000013960 ; RP23-143A14.3-001; intron 1

  ENSMUST00000134252 ; 1700016P03Rik-001; intron 1

  ENSMUST00000083603 ; Mir132-201; exon 1

Clustered miRNAs

< 10kb from mmu-mir-132

• mmu-mir-212: chr11: 75173388-75173478 [+]
• mmu-mir-132: chr11: 75173682-75173747 [+]

Database links

• EntrezGene:Mir132
• MGI:Mir132
• RNAcentral:URS000075ABE4_10090
• miRBase Tracker:MI0000158

Mature sequence mmu-miR-132-5p

• Accession: MIMAT0016984
• Previous IDs: mmu-miR-132*
• Sequence: 5 - aaccguggcuuucgauuguuac - 26
• Deep sequencing: 10315 reads, 89 experiments
• Evidence: experimental; 454 [4], Illumina [5]
• Database links:
  • RNAcentral:URS000032AEB0_10090
• Predicted targets:
  • miRDB:mmu-miR-132-5p

Mature sequence mmu-miR-132-3p

• Accession: MIMAT0000144
• Previous IDs: mmu-miR-132
• Sequence: 42 - uaacagucuacagccauggucg - 63
• Deep sequencing: 147423 reads, 105 experiments
• Evidence: experimental; cloned [1-2], Illumina [3,5]
• Database links:
  • RNAcentral:URS00006054DA_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-132-3p
  • miRDB:mmu-miR-132-3p
  • microrna.org:mmu-miR-132-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).