![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-130a |
|||||
Accession | MI0000156 (change log) | ||||
Previous IDs | mmu-mir-130 | ||||
Symbol | MGI:Mir130a | ||||
Description | Mus musculus miR-130a stem-loop | ||||
Gene family | MIPF0000034; mir-130 | ||||
Literature search |
![]()
90 open access papers mention mmu-mir-130a | ||||
Stem-loop |
-ga c ug a -- - ua 5' gcucuuuu acauug cu cu gu c a |||||||| |||||| || || || | 3' cgggaaaa uguaac ga ga ca g c cua u gu c gc u ug |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This sequence was named miR-130 in reference [1], but is renamed here to avoid confusion with miR-130b (MI0000408). |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-130a-5p |
|
Accession | MIMAT0016983 |
Previous IDs | mmu-miR-130a* |
Sequence |
3 - gcucuuuucacauugugcuacu - 24 |
Deep sequencing | 491 reads, 54 experiments |
Evidence | experimental; Illumina [8] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-130a-3p |
|
Accession | MIMAT0000141 |
Previous IDs | mmu-miR-130a |
Sequence |
42 - cagugcaauguuaaaagggcau - 63 |
Deep sequencing | 266698 reads, 106 experiments |
Evidence | experimental; cloned [1-2,4-6], Northern [2], Illumina [7] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
3 |
PMID:12554860
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
4 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
5 | |
6 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
7 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
8 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|