Stem-loop sequence mmu-mir-125b-2

Accession

MI0000152 (change log)

Previous IDs

mmu-mir-125b

Symbol

MGI:Mir125b-2

Description

Mus musculus miR-125b-2 stem-loop

Gene family

MIPF0000033; mir-10

Literature search

260 open access papers mention mmu-mir-125b-2
(1492 sentences)

Stem-loop

         uc  ug   c   a        -gg   u 
5' gccuag  cc  aga ccu acuuguga   uau u
   ||||||  ||  ||| ||| ||||||||   |||  
3' cggauc  gg  ucu gga ugaacacu   aug u
         ca  gu   u   c        aca   a 

Deep sequencing

2279045 reads, 1.01e+04 reads per million, 106 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Mouse miR-125b was cloned from mouse brain tissues in [1]. There are 2 predicted hairpin precursor structures in the mouse genome, each has a closely related human homologue [2] (mir-125b-1, MI0000725; mir-125b-2, MI0000152; the latter was previously named mir-125b here).

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr16: 77646273-77646343 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000113997 ; RP24-252G15.1-013; intron 3

  OTTMUST00000113989 ; RP24-252G15.1-003; intron 5

  OTTMUST00000113994 ; RP24-252G15.1-006; intron 7

  ENSMUST00000183327 ; 2810055G20Rik-013; intron 3

  ENSMUST00000183099 ; 2810055G20Rik-003; intron 5

  ENSMUST00000182820 ; 2810055G20Rik-006; intron 7

Database links

• EntrezGene:Mir125b-2
• MGI:Mir125b-2
• RNAcentral:URS000075DBD1_10090
• Rfam:lin-4
• miRBase Tracker:MI0000152

Mature sequence mmu-miR-125b-5p

• Accession: MIMAT0000136
• Previous IDs: mmu-miR-125b
• Sequence: 7 - ucccugagacccuaacuuguga - 28
• Deep sequencing: 4485548 reads, 109 experiments
• Evidence: experimental; cloned [1,3-4], Illumina [5-6]
• Database links:
  • RNAcentral:URS0000209905_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-125b-5p
  • miRDB:mmu-miR-125b-5p
  • microrna.org:mmu-miR-125b-5p

Mature sequence mmu-miR-125b-2-3p

• Accession: MIMAT0004529
• Previous IDs: mmu-miR-125b*
• Sequence: 46 - acaagucagguucuugggaccu - 67
• Deep sequencing: 60805 reads, 81 experiments
• Evidence: experimental; cloned [4], Illumina [5-6]
• Database links:
  • RNAcentral:URS000030A921_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-125b-2-3p
  • miRDB:mmu-miR-125b-2-3p
  • microrna.org:mmu-miR-125b-2-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).