Stem-loop sequence mmu-mir-1a-1

Accession

MI0000139 (change log)

Previous IDs

mmu-mir-1d;mmu-mir-1-1

Symbol

MGI:Mir1a-1

Description

Mus musculus miR-1a-1 stem-loop

Gene family

MIPF0000038; mir-1

Literature search

287 open access papers mention mmu-mir-1a-1
(2925 sentences)

Stem-loop

        gg c                gc     ugaacc 
5' gcuug  a acauacuucuuuauau  ccaua      u
   |||||  | ||||||||||||||||  |||||       
3' cggac  u uguaugaagaaaugua  gguau      g
        uu a                -a     cgaauc 

Deep sequencing

26186580 reads, 1.76e+04 reads per million, 100 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Lagos-Quintana et al. [1] reported the cloning of miR-1b, miR-1c and miR-1d. The mature processed miR sequences are identical apart from the 3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residues of both miR-1b and miR-1c conflict with the predicted stem-loop precursor sequence shown here and these sequences are not found in current assemblies of human and mouse genomes. It is suggested that polyA polymerase may add 1-3 nts to the 3' end of the mature transcript (Tom Tuschl, pers. comm.). The common 21 nts of the 3 reported miR sequences have been rationalised here and named miR-1. There are 2 pairs of orthologous putative hairpin precursor structures named mir-1-1 (human MI0000651, mouse MI0000139), and mir-1-2 (human MI0000437, mouse MI0000652). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr2: 180389048-180389124 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from mmu-mir-1a-1

• mmu-mir-1a-1: chr2: 180389048-180389124 [+]
• mmu-mir-133a-2: chr2: 180398379-180398482 [+]

Database links

• EntrezGene:Mir1-1
• MGI:Mir1a-1
• RNAcentral:URS000069B691_10090
• Rfam:mir-1
• miRBase Tracker:MI0000139

Mature sequence mmu-miR-1a-1-5p

• Accession: MIMAT0016979
• Previous IDs: mmu-miR-1-1*;mmu-miR-1a-1*
• Sequence: 10 - acauacuucuuuauaugcccaua - 32
• Deep sequencing: 143 reads, 14 experiments
• Evidence: experimental; Illumina [3]
• Database links:
  • RNAcentral:URS0000332B22_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-1a-1-5p
  • miRDB:mmu-miR-1a-1-5p

Mature sequence mmu-miR-1a-3p

• Accession: MIMAT0000123
• Previous IDs: mmu-miR-1;mmu-miR-1a
• Sequence: 49 - uggaauguaaagaaguauguau - 70
• Deep sequencing: 52372476 reads, 100 experiments
• Evidence: experimental; cloned [1-2], Illumina [3]
• Database links:
  • RNAcentral:URS00001DC04F_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-1a-3p
  • miRDB:mmu-miR-1a-3p
  • microrna.org:mmu-miR-1a-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).