Stem-loop sequence dme-mir-14

Accession

MI0000136 (change log)

Description

Drosophila melanogaster miR-14 stem-loop

Gene family

MIPF0000182; mir-14

Literature search

24 open access papers mention dme-mir-14
(167 sentences)

Stem-loop

           c    cg      c     gcu 
5' ugugggag gaga  gggacu acugu   u
   |||||||| ||||  |||||| |||||   a
3' auauccuc cucu  uucuga ugaua   u
           u    uu      c     aau 

Deep sequencing

1859507 reads, 5.69e+04 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-14 has been reported to act as a cell death repressor and regulator of fat metabolism [2].

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr2R: 9553762-9553824 [+]
• Overlapping transcripts:

  sense

  FBtr0310105 ; CR43651-RB; exon 1

  FBtr0310104 ; CR43651-RA; exon 1

Database links

• RNAcentral:URS00005F206D_7227
• miRBase Tracker:MI0000136

Mature sequence dme-miR-14-5p

• Accession: MIMAT0020798
• Sequence: 4 - gggagcgagacggggacucacu - 25
• Deep sequencing: 297149 reads, 49 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS0000224E80_7227

Mature sequence dme-miR-14-3p

• Accession: MIMAT0000120
• Previous IDs: dme-miR-14
• Sequence: 41 - ucagucuuuuucucucuccuau - 62
• Deep sequencing: 1562350 reads, 49 experiments
• Evidence: experimental; cloned [1,4], Northern [3], 454 [5-6], Illumina [6]
• Database links:
  • RNAcentral:URS00003DE3EC_7227
• Predicted targets:
  • TargetScanFly:dme-miR-14
  • microrna.org:dme-miR-14-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:12725740 "The Drosophila microRNA Mir-14 suppresses cell death and is required for normal fat metabolism" Xu P, Vernooy SY, Guo M, Hay BA Curr Biol. 13:790-795(2003).
3. PMID:12812784 "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity" Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V Dev Biol. 259:9-18(2003).
4. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
5. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
6. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).