![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dme-mir-13b-1 |
||||||||
Accession | MI0000134 (change log) | |||||||
Description | Drosophila melanogaster miR-13b-1 stem-loop | |||||||
Gene family | MIPF0000049; mir-2 | |||||||
Literature search |
![]()
13 open access papers mention dme-mir-13b-1 | |||||||
Stem-loop |
-ug u acu uauu 5' cca ucguuaaaaug uuguga uaug c ||| ||||||||||| |||||| |||| 3' ggu agcaguuuuac gacacu auac a uug c --- uaac |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence dme-miR-13b-1-5p |
|
Accession | MIMAT0020796 |
Sequence |
6 - ucguuaaaauguuugugaacuuaug - 30 |
Deep sequencing | 535 reads, 40 experiments |
Evidence | not experimental |
Database links |
|
Mature sequence dme-miR-13b-3p |
|
Accession | MIMAT0000119 |
Previous IDs | dme-miR-13b |
Sequence |
43 - uaucacagccauuuugacgagu - 64 |
Deep sequencing | 751302 reads, 49 experiments |
Evidence | experimental; Northern [1-2], cloned [3], 454 [4-5], Illumina [5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:11679670
"Identification of novel genes coding for small expressed RNAs"
Science. 294:853-858(2001).
|
2 | |
3 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
4 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
5 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|