![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dme-mir-13a |
||||||||
Accession | MI0000133 (change log) | |||||||
Description | Drosophila melanogaster miR-13a stem-loop | |||||||
Gene family | MIPF0000049; mir-2 | |||||||
Literature search |
![]()
12 open access papers mention dme-mir-13a | |||||||
Stem-loop |
u c - a --uc cu 5' uacg aacuc ucaaag gguuguga aug ga a |||| ||||| |||||| |||||||| ||| || 3' gugc uugag aguuuu ccgacacu uac cu u u u a a ucau au |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence dme-miR-13a-5p |
|
Accession | MIMAT0020795 |
Sequence |
8 - cuccucaaaggguugugaaaug - 29 |
Deep sequencing | 370 reads, 40 experiments |
Evidence | not experimental |
Database links |
|
Mature sequence dme-miR-13a-3p |
|
Accession | MIMAT0000118 |
Previous IDs | dme-miR-13a |
Sequence |
48 - uaucacagccauuuugaugagu - 69 |
Deep sequencing | 367510 reads, 49 experiments |
Evidence | experimental; cloned [1], Northern [1-2], 454 [3-4], Illumina [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:11679670
"Identification of novel genes coding for small expressed RNAs"
Science. 294:853-858(2001).
|
2 | |
3 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
4 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|