Stem-loop sequence dme-mir-12

Accession

MI0000132 (change log)

Description

Drosophila melanogaster miR-12 stem-loop

Gene family

MIPF0000181; mir-12

Literature search

11 open access papers mention dme-mir-12
(35 sentences)

Stem-loop

         ug     u    c          -  gccuu 
5' uacggu  aguau acau agguacuggu gu     a
   ||||||  ||||| |||| |||||||||| ||      
3' gugccg  ucaua ugua uucaugacca ca     a
         ca     c    -          a  accua 

Deep sequencing

2294444 reads, 1.74e+04 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Release_6; GCA_000001215.4): chrX: 15509473-15509546 [+]
• Overlapping transcripts:

  sense

  FBtr0074043 ; Gmap-RB; intron 4

  FBtr0074042 ; Gmap-RA; intron 5

Clustered miRNAs

< 10kb from dme-mir-12

• dme-mir-283: chrX: 15507956-15508055 [+]
• dme-mir-304: chrX: 15508959-15509046 [+]
• dme-mir-12: chrX: 15509473-15509546 [+]

Database links

• RNAcentral:URS0000220FA8_7227
• miRBase Tracker:MI0000132

Mature sequence dme-miR-12-5p

• Accession: MIMAT0000117
• Previous IDs: dme-miR-12
• Sequence: 7 - ugaguauuacaucagguacuggu - 29
• Deep sequencing: 2292938 reads, 49 experiments
• Evidence: experimental; cloned [1,3], Northern [1-2], 454 [4-5], Illumina [5]
• Database links:
  • RNAcentral:URS0000588E2B_7227
• Predicted targets:
  • microrna.org:dme-miR-12-5p

Mature sequence dme-miR-12-3p

• Accession: MIMAT0020794
• Sequence: 49 - caguacuuaugucauacuacgc - 70
• Deep sequencing: 1373 reads, 47 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS00005FA7ED_7227

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:12812784 "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity" Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V Dev Biol. 259:9-18(2003).
3. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).