Stem-loop sequence dme-mir-11

Accession

MI0000131 (change log)

Description

Drosophila melanogaster miR-11 stem-loop

Gene family

MIPF0000252; mir-11

Literature search

9 open access papers mention dme-mir-11
(54 sentences)

Stem-loop

          u         ucu      ccc   u  acu 
5' gcacuug caagaacuu   cuguga   gcg gu   u
   ||||||| |||||||||   ||||||   ||| ||    
3' cgugagu guucuugag   gacacu   cgc cg   a
          c         ucu      --a   -  aaa 

Deep sequencing

1794768 reads, 1.51e+04 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr3R: 21622497-21622571 [-]
• Overlapping transcripts:

  sense

  FBtr0084118 ; E2f-RC; intron 5

  FBtr0084119 ; E2f-RA; intron 5

  FBtr0084117 ; E2f-RB; intron 7

Clustered miRNAs

< 10kb from dme-mir-11

• dme-mir-11: chr3R: 21622497-21622571 [-]
• dme-mir-998: chr3R: 21621879-21622021 [-]

Database links

• RNAcentral:URS00001508CB_7227
• miRBase Tracker:MI0000131

Mature sequence dme-miR-11-5p

• Accession: MIMAT0020793
• Sequence: 9 - caagaacuuucucugugacccg - 30
• Deep sequencing: 56468 reads, 49 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS00004DA476_7227

Mature sequence dme-miR-11-3p

• Accession: MIMAT0000116
• Previous IDs: dme-miR-11
• Sequence: 48 - caucacagucugaguucuugc - 68
• Deep sequencing: 1738283 reads, 49 experiments
• Evidence: experimental; cloned [1,3], Northern [1-2], 454 [4-5], Illumina [5]
• Database links:
  • RNAcentral:URS00005413DD_7227
• Predicted targets:
  • TargetScanFly:dme-miR-11
  • microrna.org:dme-miR-11-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:12812784 "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity" Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V Dev Biol. 259:9-18(2003).
3. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).