Stem-loop sequence dme-mir-9a

Accession

MI0000129 (change log)

Previous IDs

dme-mir-9

Description

Drosophila melanogaster miR-9a stem-loop

Gene family

MIPF0000014; mir-9

Literature search

33 open access papers mention dme-mir-9a
(381 sentences)

Stem-loop

       -     u       uau      g     -  gau 
5' gcua uguug cuuuggu   cuagcu uauga gu   a
   |||| ||||| |||||||   |||||| ||||| ||    
3' cgau auaau gaagcca   gaucga auacu ca   a
       u     u       uuc      a     g  aua 

Deep sequencing

723461 reads, 8.51e+03 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr3L: 19565131-19565208 [+]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS0000489A4A_7227
• miRBase Tracker:MI0000129

Mature sequence dme-miR-9a-5p

• Accession: MIMAT0000114
• Previous IDs: dme-miR-9a
• Sequence: 10 - ucuuugguuaucuagcuguauga - 32
• Deep sequencing: 719142 reads, 49 experiments
• Evidence: experimental; cloned [1,3], Northern [1-3], 454 [4-5], Illumina [5]
• Database links:
  • RNAcentral:URS00004208C5_7227
• Predicted targets:
  • TargetScanFly:dme-miR-9a
  • microrna.org:dme-miR-9a-5p

Mature sequence dme-miR-9a-3p

• Accession: MIMAT0020792
• Sequence: 49 - uaaagcuagcuuaccgaaguua - 70
• Deep sequencing: 4314 reads, 48 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS00003ADB7F_7227

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:12812784 "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity" Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V Dev Biol. 259:9-18(2003).
3. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).