Stem-loop sequence dme-mir-7

AccessionMI0000127 (change log)
DescriptionDrosophila melanogaster miR-7 stem-loop
Gene family MIPF0000022; mir-7
Literature search

31 open access papers mention dme-mir-7
(264 sentences)

Stem-loop 
           u     u       u  u     u      uggu u 
5' gagugcau ccgua ggaagac ag gauuu guuguu    c u
   |||||||| ||||| ||||||| || ||||| ||||||    |  
3' uuuacgug ggcau ucuucug uc cuaaa uaacaa    g u
           c     -       u  c     -      uaau g
Get sequence
Deep sequencing
551941 reads, 3.93e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Stark et al. [2] have identified targets for miR-7 in Drosophila using computational prediction followed by experimental validation. miR-7 regulates a family of Notch targets including the Enhancer of split and Bearded complex genes Tom and m4, and the basic helix-loop-helix transcriptional repressors HLHm3 and hairy.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 20606067-20606154 [+]
sense
FBtr0086219 ; bl-RB; intron 8
FBtr0086220 ; bl-RA; intron 8
FBtr0301760 ; bl-RE; intron 8
FBtr0086221 ; bl-RC; intron 9
Database links

Mature sequence dme-miR-7-5p

Accession MIMAT0000112
Previous IDsdme-miR-7
Sequence

15 -  

uggaagacuagugauuuuguugu

 - 37

Get sequence
Deep sequencing549630 reads, 49 experiments
Evidence experimental; cloned [1,4], Northern [1,3-4], 454 [5-6], Illumina [6]
Database links
Predicted targets

Mature sequence dme-miR-7-3p

Accession MIMAT0020790
Sequence

55 -  

caauaaaucccuugucuucuua

 - 76

Get sequence
Deep sequencing2093 reads, 46 experiments
Evidence not experimental
Database links

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:14691535 "Identification of Drosophila MicroRNA targets" Stark A, Brennecke J, Russell RB, Cohen SM PLoS Biol. 1:E60(2003).
3
PMID:12812784 "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity" Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V Dev Biol. 259:9-18(2003).
4
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
5
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
6
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).