![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dme-mir-7 |
|||||
Accession | MI0000127 (change log) | ||||
Description | Drosophila melanogaster miR-7 stem-loop | ||||
Gene family | MIPF0000022; mir-7 | ||||
Literature search |
![]()
31 open access papers mention dme-mir-7 | ||||
Stem-loop |
u u u u u uggu u 5' gagugcau ccgua ggaagac ag gauuu guuguu c u |||||||| ||||| ||||||| || ||||| |||||| | 3' uuuacgug ggcau ucuucug uc cuaaa uaacaa g u c - u c - uaau g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
Stark et al. [2] have identified targets for miR-7 in Drosophila using computational prediction followed by experimental validation. miR-7 regulates a family of Notch targets including the Enhancer of split and Bearded complex genes Tom and m4, and the basic helix-loop-helix transcriptional repressors HLHm3 and hairy. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence dme-miR-7-5p |
|
Accession | MIMAT0000112 |
Previous IDs | dme-miR-7 |
Sequence |
15 - uggaagacuagugauuuuguugu - 37 |
Deep sequencing | 549630 reads, 49 experiments |
Evidence | experimental; cloned [1,4], Northern [1,3-4], 454 [5-6], Illumina [6] |
Database links |
|
Predicted targets |
|
Mature sequence dme-miR-7-3p |
|
Accession | MIMAT0020790 |
Sequence |
55 - caauaaaucccuugucuucuua - 76 |
Deep sequencing | 2093 reads, 46 experiments |
Evidence | not experimental |
Database links |
|
References |
|
1 |
PMID:11679670
"Identification of novel genes coding for small expressed RNAs"
Science. 294:853-858(2001).
|
2 |
PMID:14691535
"Identification of Drosophila MicroRNA targets"
PLoS Biol. 1:E60(2003).
|
3 | |
4 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
5 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
6 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|