miRBase entry: hsa-mir-103a-2

Stem-loop hsa-mir-103a-2


Accession
MI0000108
Symbol
HGNC: MIR103A2
Description
Homo sapiens hsa-mir-103a-2 precursor miRNA
Gene family
MIPF0000024; mir-103

Literature search
258 open access papers mention hsa-mir-103a-2
(975 sentences)

Sequence

5004011 reads, 15897 reads per million, 156 experiments
uugugcuuucAGCUUCUUUACAGUGCUGCCUUGuagcauucaggucaAGCAGCAUUGUACAGGGCUAUGAaagaacca
..((.(((((((((.((.(((((((((((.(((.(.(.....).))))))))))))))).)))))..)))))).))..

Structure
uu  g      --   U  U           C   u g a 
  gu cuuucA  GCU CU UACAGUGCUGC UUG a c u
  || ||||||  ||| || ||||||||||| ||| | | u
  ca gaaAGU  CGG GA AUGUUACGACG Aac u g c
ac  a      AU   -  C           -   - g a 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was localised to chromosome 20 and named mir-103-20 in reference [1].

Genome context
chr20: 3917494-3917571 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-103a-2
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-103a-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-103a-2-5p

Accession MIMAT0009196
Description Homo sapiens hsa-miR-103a-2-5p mature miRNA
Sequence 11 - AGCUUCUUUACAGUGCUGCCUUG - 33
Evidence experimental
454 [5]
Database links
Predicted targets

Mature hsa-miR-103a-3p

Accession MIMAT0000101
Description Homo sapiens hsa-miR-103a-3p mature miRNA
Sequence 48 - AGCAGCAUUGUACAGGGCUAUGA - 70
Evidence experimental
cloned [1-4], Northern [2], Illumina [5]
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  5. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728

  6. PubMed ID: 19144710
    Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas
    "Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G"
    "J Virol (2009) 83:3333-3341