miRBase entry: hsa-mir-100

Stem-loop hsa-mir-100


Accession
MI0000102
Symbol
HGNC: MIR100
Description
Homo sapiens hsa-mir-100 precursor miRNA
Gene family
MIPF0000033; mir-10

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR100 is a microRNA that has been studied in various contexts. In a study using the Akaike information criteria, the combination of CD146 and CD144 among the extracellular vesicle (EV) membrane proteins, along with MIR100 and miR194, showed high multivariate AUROC values of 0.922 and 0.970, respectively [PMC8821147]. Additionally, an miR-100 expression vector called pBABE MIR100 was constructed using the pBABE-puro retrovirus vector [PMC9873580]. MiR101 was found to regulate Rab1a formation, while MIR100 and miR101 (along with miR15b, miR20a, miR92a, and miR132) were found to play a role in apoptosis by targeting inhibitors of the intrinsic apoptosis pathway [PMC7123062]. These findings highlight the importance of MIR100 in various biological processes and its potential as a therapeutic target or biomarker.

Literature search
205 open access papers mention hsa-mir-100
(1536 sentences)

Sequence

352936 reads, 1446 reads per million, 140 experiments
ccuguugccacaAACCCGUAGAUCCGAACUUGUGguauuaguccgcaCAAGCUUGUAUCUAUAGGUAUGugucuguuagg
((((....((((.(((.((((((.(((.((((((...........)))))).))).)))))).))).)))).....))))

Structure
    -uugc    A   C      C   A      guau 
ccug     caca ACC GUAGAU CGA CUUGUG    u
||||     |||| ||| |||||| ||| ||||||    a
ggau     guGU UGG UAUCUA GUU GAACac    g
    ugucu    A   A      U   C      gccu 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence is localised to chromosome 11 and was named mir-100-11 in reference [1].

Genome context
chr11: 122152229-122152308 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-100
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-100 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-100-5p

Accession MIMAT0000098
Description Homo sapiens hsa-miR-100-5p mature miRNA
Sequence 13 - AACCCGUAGAUCCGAACUUGUG - 34
Evidence experimental
cloned [1-3], Illumina [4]
Database links
Predicted targets

Mature hsa-miR-100-3p

Accession MIMAT0004512
Description Homo sapiens hsa-miR-100-3p mature miRNA
Sequence 48 - CAAGCUUGUAUCUAUAGGUAUG - 69
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  4. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728