miRBase entry: hsa-mir-23a

Stem-loop hsa-mir-23a


Accession
MI0000079
Symbol
HGNC: MIR23A
Description
Homo sapiens hsa-mir-23a precursor miRNA
Gene family
MIPF0000027; mir-23

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Hsa-mir-23a is a microRNA that was found to be significantly deregulated in the saliva of resectable pancreatic ductal adenocarcinoma (PDAC) patients compared to healthy controls during the discovery phase [PMC4486170]. However, it was not further investigated as it did not exhibit at least a 4-fold change in expression between the two groups [PMC4486170]. In addition to hsa-mir-23a, other miRNAs were also found to be deregulated in PDAC patients [PMC9004059]. Six miRNAs (hsa-miR-15a, hsa-let-7d, hsa-miR-142, hsa-mir-23a, hsa-miR-199, and hsa-miR-191) were found to be elevated in PDAC patients [PMC9004059]. MiRNA-regulated genes have been implicated in various biological processes such as central nervous system development, congenital abnormalities, and heart problems [PMC9004059].

Literature search
329 open access papers mention hsa-mir-23a
(1790 sentences)

Sequence

945129 reads, 5463 reads per million, 135 experiments
ggccggcuGGGGUUCCUGGGGAUGGGAUUUgcuuccugucacaaAUCACAUUGCCAGGGAUUUCCaaccgacc
((.(((.((((((((((((.((((.((((((..........)))))).)))).))))))).))))).))).))

Structure
  c   c     -       G    G      cuuc 
gg cgg uGGGG UUCCUGG GAUG GAUUUg    c
|| ||| ||||| ||||||| |||| ||||||     
cc gcc aCCUU AGGGACC UUAC CUAaac    u
  a   a     U       G    A      acug 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA was previously named miR-23 [1,2] but is renamed here to avoid confusion with the more recently described miR-23b (MIR:MI0000439). Kawasaki and Taira reported that miR-23 regulates the transcriptional repressor Hairy enhancer of split (HES1) [3]. This finding was later retracted after the discovery that the regulated gene was human homolog of ES1 (HES1), whose function is unknown.

Genome context
chr19: 13836587-13836659 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-23a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-23a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-23a-5p

Accession MIMAT0004496
Description Homo sapiens hsa-miR-23a-5p mature miRNA
Sequence 9 - GGGGUUCCUGGGGAUGGGAUUU - 30
Evidence experimental
cloned [6-7]
Database links
Predicted targets

Mature hsa-miR-23a-3p

Accession MIMAT0000078
Description Homo sapiens hsa-miR-23a-3p mature miRNA
Sequence 45 - AUCACAUUGCCAGGGAUUUCC - 65
Evidence experimental
cloned [1,4-7], Northern [1]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  3. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  4. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  5. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  6. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728

  7. PubMed ID: 12808467
    Hes1 is a target of microRNA-23 during retinoic-acid-induced neuronal differentiation of NT2 cells
    "Kawasaki H, Taira K"
    "Nature (2003) 423:838-842