miRBase entry: hsa-let-7c

Stem-loop hsa-let-7c


Accession
MI0000064
Symbol
HGNC: MIRLET7C
Description
Homo sapiens hsa-let-7c precursor miRNA
Gene family
MIPF0000002; let-7

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Hsa-let-7c is a microRNA that has been studied in relation to osteo/odontogenic markers. The mRNA expression levels of hsa-let-7c and several osteo/odontogenic markers were detected using specific primer sets [PMC5938007]. Subsequent validation experiments were conducted using TaqMan® micro-RNA assays on fetal and adult eye samples. The targeted micro-RNAs in these experiments included hsa-let-7c, among others, which showed collagen specificity [PMC3804513]. However, no correlation was observed between the expression level of hsa-let-7c and PGC, hsa_circ_000483, or hsa_circ_0001324 [PMC8176405]. 

In summary, the expression levels of hsa-let-7c and several osteo/odontogenic markers were detected using specific primer sets [PMC5938007]. Subsequent validation experiments on fetal and adult eye samples showed collagen specificity for hsa-let-7c [PMC3804513]. However, no correlation was found between the expression level of hsa-let-7c and PGC, hsa_circ_000483, or hsa_circ_0001324 [PMC8176405].

Literature search
1116 open access papers mention hsa-let-7c
(6702 sentences)

Sequence

5923990 reads, 15711 reads per million, 156 experiments
gcauccggguUGAGGUAGUAGGUUGUAUGGUUuagaguuacacccugggaguuaaCUGUACAACCUUCUAGCUUUCCuuggagc
((.((((((..(((.(((.(((((((((((((..((.(..((...))..).))))))))))))))).))).)))..))))))))

Structure
  a      uU   G   U             ua  g ua  c 
gc uccggg  GAG UAG AGGUUGUAUGGUU  ga u  ca  
|| ||||||  ||| ||| |||||||||||||  || |  || c
cg agguuC  UUC AUC UCCAACAUGUCaa  uu a  gu  
  -      CU   G   U             --  g gg  c 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr21: 16539828-16539911 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-let-7c
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-let-7c is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-let-7c is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-let-7c is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-let-7c-5p

Accession MIMAT0000064
Description Homo sapiens hsa-let-7c-5p mature miRNA
Sequence 11 - UGAGGUAGUAGGUUGUAUGGUU - 32
Evidence experimental
cloned [1-4], Northern [1], Illumina [5-6]
Database links
Predicted targets

Mature hsa-let-7c-3p

Accession MIMAT0026472
Description Homo sapiens hsa-let-7c-3p mature miRNA
Sequence 56 - CUGUACAACCUUCUAGCUUUCC - 77
Evidence experimental
Illumina [6]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  3. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  4. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  5. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  6. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45