MIRLET7B is the host gene of miR-let-7b-5p (hereafter referred to as miR-let-7b) that is augmented during oxygen exposure, causing oxidative stress and senescence in the choroid and retinal pigment epithelium through the p53–let-7b–IGF-1R axis, but the role of miR-let-7b in cell senescence remains unclear [1]. LYPLAL1-AS1 directly interacts with the MIRLET7B promoter and regulates its activity negatively [1]. FOXO3 very likely regulates the expression of MIRLET7B and MIRLET7C [2]. LYPLAL1-AS1 binds to a specific region of the MIRLET7B promoter on chromosome 22, as shown by ChIRP-seq analysis using Integrative Genomics Viewer software [1]. During dissociation-induced retinal pigment epithelial epithelial-mesenchymal transition, several microRNA host genes, including MIRLET7B, are upregulated or downregulated at different time points [3]. The transcription factor NKX2-5 positively regulates target genes MIR29C and MIRLET7B when mutated [4]. A novel conditional allele for the bicistronic mirLet7c2 and MIRLET7B miRNAs was generated using homologous recombination in mouse ES cells for targeted manipulation of these specific microRNAs [5]. References: [1] PMC9022335 [2] PMC5695745 [3] PMC8024778 [4] PMC6566633 [5] PMC3814644
U ----- --a u cgggg GAGGUAGUAGGUUGUGUGGU Uuc gggcag g ||||| |||||||||||||||||||| ||| |||||| a guCCC UUCCGUCAUCCAACAUAUCa agg cccguu u - auaga cuc g
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000063 |
Description | Homo sapiens hsa-let-7b-5p mature miRNA |
Sequence | 6 - UGAGGUAGUAGGUUGUGUGGUU - 27 |
Evidence |
experimental
cloned [1,3-5], Northern [1] |
Database links | |
Predicted targets |
Accession | MIMAT0004482 |
Description | Homo sapiens hsa-let-7b-3p mature miRNA |
Sequence | 60 - CUAUACAACCUACUGCCUUCCC - 81 |
Evidence |
experimental
cloned [4-5] |
Database links | |
Predicted targets |
|