Mature sequence cel-miR-58c

Accession numberMIMAT0049030
IDcel-miR-58c
Stem-Loop cel-mir-58c
Sequence
agagaucaggcaauagguucaaa
Get sequence
Deep sequencing262 reads, 16 experiments

References

1
PMID:28645154 "ALG-5 is a miRNA-associated Argonaute required for proper developmental timing in the Caenorhabditis elegans germline" Brown KC, Svendsen JM, Tucci RM, Montgomery BE, Montgomery TA Nucleic Acids Res. 45:9093-9107(2017).