Mature sequence hsa-miR-12131

Accession numberMIMAT0049025
IDhsa-miR-12131
Stem-Loop hsa-mir-12131
Sequence
uuuggagagguguacuccca
Get sequence
Deep sequencing7 reads, 4 experiments

References

1
PMID:28471449 "Loss of miR-514a-3p regulation of PEG3 activates the NF-kappa B pathway in human testicular germ cell tumors" Ozata DM, Li X, Lee L, Liu J, Warsito D, Hajeri P, Hultman I, Fotouhi O, Marklund S, Ahrlund-Richter L, Juhlin CC, Larsson C, Lui WO Cell Death Dis. 8:e2759(2017).