Mature sequence mle-miR-8-3p

Accession numberMIMAT0048705
IDmle-miR-8-3p
Stem-Loop mle-mir-8
Sequence
uaauacugucagguaaagauguc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).