Mature sequence hsa-miR-6529-5p

Accession numberMIMAT0048637
IDhsa-miR-6529-5p
Stem-Loop hsa-mir-6529
Sequence
gagagaucagaggcgcagagug
Get sequence
Deep sequencing18 reads, 11 experiments

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).