Mature sequence bta-miR-12064

Accession numberMIMAT0046771
IDbta-miR-12064
Stem-Loop bta-mir-12064
Sequence
ugguaguauuccuaguguggc
Get sequence
Deep sequencing1 reads, 1 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).