Mature sequence bta-miR-12062

Accession numberMIMAT0046769
IDbta-miR-12062
Stem-Loop bta-mir-12062
Sequence
ugggaugguccugugucacu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).