Mature sequence bta-miR-12059

Accession numberMIMAT0046766
IDbta-miR-12059
Stem-Loop bta-mir-12059
Sequence
ucuccucccacccugccuccu
Get sequence
Deep sequencing6 reads, 6 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).