Mature sequence bta-miR-12056

Accession numberMIMAT0046763
IDbta-miR-12056
Stem-Loop bta-mir-12056
Sequence
cugggaugggguugggaaggg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).