Mature sequence bta-miR-12051

Accession numberMIMAT0046754
IDbta-miR-12051
Stem-Loop bta-mir-12051
Sequence
acuccugcagcaucuguuccga
Get sequence
Deep sequencing9 reads, 8 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).